COVID-19 DNA Solutions

In December 2019, a new coronavirus (COVID-19) was discovered due to atypical viral pneumonia cases in Wuhan. In early January 2020, Synbio Technologies designed and synthesized detection probes for COVID-19 based on our independently developed Syno® qPCR primer/probe design and synthesis platform. In less than two weeks, we completed the synthesis of detection reagent materials, such as amplification primers, probes, and quality controls. Since the outbreak of COVID-19, Synbio Technologies has set up a special coronavirus emergency project team, working against time to produce virus-related probes, genes, and protein products. We are currently working with our clients and partners from hospitals, scientific research institutes, and upstream & downstream enterprises to fight the disease. We use our efforts to realize the company’s vision of “Genes for Life.” We hope that, through Synbio Technologies’s synthetic technology platforms, we can accelerate virus research and help benefit each patient’s life as soon as possible.

Competitive Advantages

  • Speed guarantee: All COVID-19 related orders will be given priority to green channel production, with 24/7 professional online support.
  • Quality assurance: ISO 13485 standards of manufacturing, high-quality raw materials, zero cross-contamination, and perfect track records.
  • Production capacity guarantee: experienced synthesis experts, first in class instruments, more than one million probe kit materials supplied per day.

Probe/Primer Synthesis for Virus Detection

According to the official website documents of WHO and China CDC, Synbio Technologies has prepared a series of primers and probe materials for COVID-19 detection in batches. We can provide a free trial package and guarantee the supply of a million copies of nucleic acid diagnostic probes daily to speed up disease detection and research.Set 01:
RdRP gene1Primer RdRP_SARSr-F2GTGARATGGTCATGTGTGGCGG
2Primer RdRP_SARSr-R1CARATGTTAAASACACTATTAGCATA
3Probe RdRP_SARSr-P1FAM-CCAGGTGGWACRTCATCMGGTGATGC-BHQ1
4Probe RdRP_SARSr-P2FAM-CAGGTGGAACCTCATCAGGAGATGC-BHQ1
E gene5Primer E_Sarbeco_F1ACAGGTACGTTAATAGTTAATAGCGT
6Primer E_Sarbeco_R2ATATTGCAGCAGTACGCACACA
7Probe E_Sarbeco_P1FAM-ACACTAGCCATCCTTACTGCGCTTCG-BHQ1
N gene8N_Sarbeco_F1CACATTGGCACCCGCAATC
9N_Sarbeco_R1GAGGAACGAGAAGAGGCTTG
10N_Sarbeco_P1FAM-ACTTCCTCAAGGAACAACATTGCCA-BHQ1
Set 02:
Target 1(ORF1ab)11Forward Primer 1abCCCTGTGGGTTTTACACTTAA
12Reverse Primer 1abACGATTGTGCATCAGCTGA
13Probe 1ab5′-FAM-CCGTCTGCGGTATGTGGAAAGGTTATGG-BHQ1-3′
Target 2(N)14Forward Primer NGGGGAACTTCTCCTGCTAGAAT
15Reverse Primer NCAGACATTTTGCTCTCAAGCTG
16Probe N5′-FAM-TTGCTGCTGCTTGACAGATT-TAMRA-3′
Set 03:
Endogenous control17RNAse P-20013001AGATTTGGACCTGCGAGCG
18RNAse P-20013002GAGCGGCTGTCTCCACAAGT
19Probe 1abFAM-TTCTGACCTGAAGGCTCTGCGCG-BHQ1
* Sequences above were collected from WHO, US CDC and China CDC official website documents.

Gene Synthesis & Protein Expression for COVID-19

Synbio Technologies’ Syno® DNA synthesis platform provides fast gene and fragment synthesis, high-throughput synthesis, metabolic pathways, gene assembly, etc. The independently developed CI sequence difficulty index system can facilitate the accurate, fast, and high-quality synthesis of any sequence. Currently, we have completed the synthesis of all structural and non-structural protein genes or gene fragments of the COVID-19. This has promoted the acquisition of the virus recombinant proteins and the research of its protein structural biology. The virus-related target gene synthesis has been mass-produced, and can be delivered directly for research use only.

RdRP gene standards (plasmid)GTGAAATGGTCATGTGTGGCGGTTCACTATATGTTAAACCAGGTGGAACCTCATCAGGAGATGCCACAACTGCTTATGCTAATAGT
E gene standards (plasmid)ACAGGTACGTTAATAGTTAATAGCGTACTTCTTTTTCTTGCTTTCGTGGTATTCTTGCTAGTTACACTAGCCATCCTTACTGCGCTTCGATTGTGTGC
N gene standards1 (plasmid)CACATTGGCACCCGCAATCCTGCTAACAATGCTGCAATCGTGCTACAACTTCCTCAAGGAACAACATTGCCAAAAGGCTTCTACGCAGAAG
N gene standards2 (plasmid)GGGGAACTTCTCCTGCTAGAATGGCTGGCAATGGCGGTGATGCTGCTCTTGCTTTGCTGCTGCTTGACAGATTGAACCAGCTTGAG
ORF1ab gene standards (plasmid)CCCTGTGGGTTTTACACTTAAAAACACAGTCTGTACCGTCTGCGGTATGTGGAAAGGTTATGGCTGTAGTTGTGATCAACTCCGCGAACCCATGCTT
OthersSurface glycoprotein
ACE2
ORF3a protein
Envelope protein
Membrane glycoprotein
ORF6 protein
ORF7a protein
ORF8 protein
Nucleocapsid phosphoprotein
ORF10 protein
* For more sequence information, please contact support@synbio-tech.com

Antibody Discovery and Vaccine Production

From SARS to COVID-19, coronaviruses are undergoing directed evolution to a certain extent. Synthetic biology is recognized as the most powerful way to study directed evolution today. DNA Reading technology has played an active role in disease diagnosis and pathogen tracing. The development of DNA & RNA vaccines cannot be separated from DNA writing technology. DNA Editing technology may have great potential in improving the efficacy of disease in the near future. Synbio Technologies focuses on the new generation of DNA technology’s development and application. Our professional and integrated ability of DNA Reading, Writing, and Editing provides powerful technical platforms for synthetic biology. Syno®Ab is our one-stop de novo antibody design and production platform based on the combination of antibody molecule computer simulation design technology with DNA manufacturing technology. It was developed for antibody drug discovery and can help researchers effectively reduce research costs and time. With an experienced bioinformatics team, Synbio Technologies can provide guaranteed design for designated targets, neutralizing antibodies, and vaccine preparation. We can efficiently serve the construction of humanized antibody libraries, genetic engineering vaccine development, chromosome / genome synthesis, etc. to meet various customer needs.
antibody-production

Antibody Production

gene-synthesis

Gene Synthesis