T Cell Antibody Sequencing Analysis



Over the past few decades, cancer immunotherapy has dramatically altered approaches toward oncology therapy. Although treatment methods such as checkpoint blocking can produce significant clinical responses, the efficacy is uneven between cancer patients and different cancer types. Due to the high heterogeneity and complexity of the tumor microenvironment, the infiltrating lymphocytes need to be analyzed in order to characterize the basic properties of different types on immune cells.

T Cells, also known as the T lymphocytes, play an important role in cell-mediated immune regulation. T cells can be separated from other lymphocytes (e.g. B cells and natural killer cells) by the T Cell receptors on the surface of the cell. Most of the human T-cells are the αβT cell since the α and β- chains are reformed on the receptors. To better understand T cell’s involvement in this regulation, Synbio Technologies provides T-cell receptors library sequencing and bioinformatics analysis. By using the targeted amplification technique, this analysis obtains the CRR3 sequence of the TCR α&β chains. Synbio Technologies also provides high throughput sequencing and bioinformatics to analyze the T-cell acceptor library. This analysis provides sensitive, precise, and reliable data for the clinical trial and innovation research related to cancer, infection or autoimmunity.

Featured Advantages

  • Unique in-house data mining tools to pre-process antibody sequencing to minimize sequencing errors such as false positives
  • Experienced bioinformatics analysis research team capable of obtaining highly valuable antibody information

Working Flow

t-cell-antibody-sequencing-analysis

Synbio Technologies Case Study

Based on the clients’ original sample, Synbio Technologies extracted the RNA, and established the T-cell library by RACE amplification. Synbio Technologies provided an intact T-cell library analysis report by high throughput sequence and bioinformatics analysis.

Results:
1. Comparison with VDJ gene reference sequences
Synbio Technologies comprised the sequenced resulted with the reference sequence from data base to remove the invalid sequence, including unmatched and stop codon region. Then decide the VDJ expression condition and specific CFR3 region by the comparison results.

2. Frequency of VDJ gene usage analysis

Table 1. the Frequency statistics of V gene usage in TRA samples

Gene_nameChain typeReadsFrequency
T21TRA1588370.21722
T13-1TRA859090.117486
T9-2TRA819850.11212
T38-2/DV8TRA505250.069096
T4TRA374090.051159
T20TRA240280.03286
T2TRA233110.031879
T7TRA220400.030141
T12-1TRA198840.027193
T5TRA175870.024051
T1-2TRA161490.022085

VDJ-gene-usage-analysis

VDJ-gene-usage-analysis-1

VDJ-gene-usage-analysis-2VDJ-gene-usage-analysis-3

3. Analysis of CDR3 region length

analysis-of-CDR3-region-length

The length of TRA-CDR3 amino acidThe length of TRA-CDR3 amino acid

4. Analysis of CDR3

Table2. Statistics of CDR3 amino acid sequence length by sequencing

CDR3ReadsFrequencylen
DNNNDMR35600.0048697
VISRTL16880.0023086
AVTGNQFY13970.001918
AVDSNYQLI8990.0012299
AVNSGNTPLV8470.00115810
AVNRDDKII7180.0009829
AVEYGNKLV7000.0009579
AATDSWGKLQ6960.00095210
AVTSGSRLT6900.0009449
SRTL6760.0009244
AVQGGSEKLV6610.00090410
LVGDTGRRALT5400.00073811

Table3. Reads of CDR3 amino acid sequence total length

CDR3ReadsFrequencylen
GACAATAACAATGACATGCGC35600.00486921
GTGATATCCAGAACCCTG15330.00209618
TCCAGAACCCTG6760.00092412
GCTGTGGATAGCAACTATCAGTTAATC6470.00088527
GCTGTGGAATATGGAAACAAGCTGGTC6440.00088127
GCTGTGAACAGAGATGACAAGATCATC5990.00081927
GCTCTGAGTGACAATGACATGCGC5130.00070224
GCTCTGAGTGAATATGGAAACAAGCTGGTC5070.00069330
GCAGAGAGTTATAATGCAGGCAACATGCTCACC4930.00067433
GCTGTGAGTGGAGGCTTTGGGAATGTGCTGCAT4870.00066633
GCTGTGAGAGCCCCGACGTACAGCAGTGCTTCCAAGATAATC4070.00055742

analysis-of-CDR3

5. Ordering of total length sequence

Table4. Reads of TRB amino acid sequence total length

Amino Acid Gene LengthAmino Acid LengthAbundance
14911470.096324
6201390.044324
5401430.040395
5161470.041955
4961410.043976
4331450.041868
3661090.041762
3871480.039055
5041430.042773
2601480.032298

6. Saturation Analysis of sequencing results

saturation-analysis-of-sequencing-resultssaturation-analysis-of-sequencing-results-1

7. The difference of the same combination of V gene and J gene combination in two samples

trb-v

Service Specification

ServiceDetailAnalysis SoftwareTAT
(Business Days)
Delivery
T-cell antibodies sequence ServiceData mining of sequencing,
Antibody information analysis etc.
R, Python
Software etc.
7-10Analysis report

* Relevant services: Monoclonal Antibody Sequencing, Immune Repertoire Sequencing, or contact us with email: quote@synbio-tech.com.

Antibodies sequence and Bioinformatics Service

If you have any questions, please feel free to contact us for assistance during business hours. Our experienced project managers will provide you with professional support to ensure the success of your project.

online-quotation
Online Inquiry
email
quote@synbio-tech.com
call
+1 732-230-3003
fax
+1 609 228 5911